ID: 1179710869

View in Genome Browser
Species Human (GRCh38)
Location 21:43212251-43212273
Sequence CCTCCCAACCTCTAGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179710866_1179710869 -3 Left 1179710866 21:43212231-43212253 CCTGGGCTTCAATCCTGACTCCT No data
Right 1179710869 21:43212251-43212273 CCTCCCAACCTCTAGTTGTGTGG No data
1179710865_1179710869 2 Left 1179710865 21:43212226-43212248 CCACACCTGGGCTTCAATCCTGA No data
Right 1179710869 21:43212251-43212273 CCTCCCAACCTCTAGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179710869 Original CRISPR CCTCCCAACCTCTAGTTGTG TGG Intergenic
No off target data available for this crispr