ID: 1179711868

View in Genome Browser
Species Human (GRCh38)
Location 21:43268178-43268200
Sequence TCAGGACCACTAAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179711868_1179711874 1 Left 1179711868 21:43268178-43268200 CCCTTCTCCCTTAGTGGTCCTGA No data
Right 1179711874 21:43268202-43268224 GAAGCCAGAGCCACATAGCATGG No data
1179711868_1179711875 2 Left 1179711868 21:43268178-43268200 CCCTTCTCCCTTAGTGGTCCTGA No data
Right 1179711875 21:43268203-43268225 AAGCCAGAGCCACATAGCATGGG No data
1179711868_1179711878 11 Left 1179711868 21:43268178-43268200 CCCTTCTCCCTTAGTGGTCCTGA No data
Right 1179711878 21:43268212-43268234 CCACATAGCATGGGCTGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179711868 Original CRISPR TCAGGACCACTAAGGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr