ID: 1179713183

View in Genome Browser
Species Human (GRCh38)
Location 21:43274650-43274672
Sequence CCACATGCAGAGACTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179713183_1179713189 1 Left 1179713183 21:43274650-43274672 CCACTCAGAGTCTCTGCATGTGG No data
Right 1179713189 21:43274674-43274696 TGGAGTTTAGCAGCTGGCTGGGG No data
1179713183_1179713186 -5 Left 1179713183 21:43274650-43274672 CCACTCAGAGTCTCTGCATGTGG No data
Right 1179713186 21:43274668-43274690 TGTGGCTGGAGTTTAGCAGCTGG No data
1179713183_1179713188 0 Left 1179713183 21:43274650-43274672 CCACTCAGAGTCTCTGCATGTGG No data
Right 1179713188 21:43274673-43274695 CTGGAGTTTAGCAGCTGGCTGGG No data
1179713183_1179713190 18 Left 1179713183 21:43274650-43274672 CCACTCAGAGTCTCTGCATGTGG No data
Right 1179713190 21:43274691-43274713 CTGGGGTGAGCCGCTGCTTGCGG No data
1179713183_1179713187 -1 Left 1179713183 21:43274650-43274672 CCACTCAGAGTCTCTGCATGTGG No data
Right 1179713187 21:43274672-43274694 GCTGGAGTTTAGCAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179713183 Original CRISPR CCACATGCAGAGACTCTGAG TGG (reversed) Intergenic
No off target data available for this crispr