ID: 1179714852

View in Genome Browser
Species Human (GRCh38)
Location 21:43281405-43281427
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714852_1179714862 17 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714852_1179714863 18 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714863 21:43281446-43281468 GGCGTGCGCTGTGGGCGGCAGGG No data
1179714852_1179714866 27 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714866 21:43281455-43281477 TGTGGGCGGCAGGGTGAGTGGGG No data
1179714852_1179714864 25 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714864 21:43281453-43281475 GCTGTGGGCGGCAGGGTGAGTGG No data
1179714852_1179714861 13 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714861 21:43281441-43281463 CTATAGGCGTGCGCTGTGGGCGG No data
1179714852_1179714860 10 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714860 21:43281438-43281460 CATCTATAGGCGTGCGCTGTGGG No data
1179714852_1179714859 9 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG No data
1179714852_1179714865 26 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714865 21:43281454-43281476 CTGTGGGCGGCAGGGTGAGTGGG No data
1179714852_1179714855 -3 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714855 21:43281425-43281447 CTCACCCCATCTGCATCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714852 Original CRISPR GAGCGGCCACCTCCTGTCCT GGG (reversed) Intergenic