ID: 1179714853

View in Genome Browser
Species Human (GRCh38)
Location 21:43281406-43281428
Sequence TGAGCGGCCACCTCCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714853_1179714864 24 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714864 21:43281453-43281475 GCTGTGGGCGGCAGGGTGAGTGG No data
1179714853_1179714860 9 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714860 21:43281438-43281460 CATCTATAGGCGTGCGCTGTGGG No data
1179714853_1179714865 25 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714865 21:43281454-43281476 CTGTGGGCGGCAGGGTGAGTGGG No data
1179714853_1179714862 16 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714853_1179714855 -4 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714855 21:43281425-43281447 CTCACCCCATCTGCATCTATAGG No data
1179714853_1179714863 17 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714863 21:43281446-43281468 GGCGTGCGCTGTGGGCGGCAGGG No data
1179714853_1179714861 12 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714861 21:43281441-43281463 CTATAGGCGTGCGCTGTGGGCGG No data
1179714853_1179714859 8 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG No data
1179714853_1179714866 26 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714866 21:43281455-43281477 TGTGGGCGGCAGGGTGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714853 Original CRISPR TGAGCGGCCACCTCCTGTCC TGG (reversed) Intergenic