ID: 1179714854

View in Genome Browser
Species Human (GRCh38)
Location 21:43281422-43281444
Sequence ATAGATGCAGATGGGGTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714854_1179714859 -8 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG No data
1179714854_1179714871 25 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714871 21:43281470-43281492 GAGTGGGGACCCCCGGGGGATGG No data
1179714854_1179714872 26 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714872 21:43281471-43281493 AGTGGGGACCCCCGGGGGATGGG No data
1179714854_1179714861 -4 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714861 21:43281441-43281463 CTATAGGCGTGCGCTGTGGGCGG No data
1179714854_1179714866 10 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714866 21:43281455-43281477 TGTGGGCGGCAGGGTGAGTGGGG No data
1179714854_1179714869 20 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714869 21:43281465-43281487 AGGGTGAGTGGGGACCCCCGGGG No data
1179714854_1179714870 21 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714870 21:43281466-43281488 GGGTGAGTGGGGACCCCCGGGGG No data
1179714854_1179714867 18 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714867 21:43281463-43281485 GCAGGGTGAGTGGGGACCCCCGG No data
1179714854_1179714863 1 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714863 21:43281446-43281468 GGCGTGCGCTGTGGGCGGCAGGG No data
1179714854_1179714860 -7 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714860 21:43281438-43281460 CATCTATAGGCGTGCGCTGTGGG No data
1179714854_1179714865 9 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714865 21:43281454-43281476 CTGTGGGCGGCAGGGTGAGTGGG No data
1179714854_1179714868 19 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714868 21:43281464-43281486 CAGGGTGAGTGGGGACCCCCGGG No data
1179714854_1179714864 8 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714864 21:43281453-43281475 GCTGTGGGCGGCAGGGTGAGTGG No data
1179714854_1179714862 0 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714854 Original CRISPR ATAGATGCAGATGGGGTGAG CGG (reversed) Intergenic
No off target data available for this crispr