ID: 1179714855

View in Genome Browser
Species Human (GRCh38)
Location 21:43281425-43281447
Sequence CTCACCCCATCTGCATCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714853_1179714855 -4 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714855 21:43281425-43281447 CTCACCCCATCTGCATCTATAGG No data
1179714852_1179714855 -3 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714855 21:43281425-43281447 CTCACCCCATCTGCATCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714855 Original CRISPR CTCACCCCATCTGCATCTAT AGG Intergenic