ID: 1179714859

View in Genome Browser
Species Human (GRCh38)
Location 21:43281437-43281459
Sequence GCATCTATAGGCGTGCGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714852_1179714859 9 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG No data
1179714853_1179714859 8 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG No data
1179714854_1179714859 -8 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714859 Original CRISPR GCATCTATAGGCGTGCGCTG TGG Intergenic
No off target data available for this crispr