ID: 1179714862

View in Genome Browser
Species Human (GRCh38)
Location 21:43281445-43281467
Sequence AGGCGTGCGCTGTGGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714858_1179714862 -9 Left 1179714858 21:43281431-43281453 CCATCTGCATCTATAGGCGTGCG No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714854_1179714862 0 Left 1179714854 21:43281422-43281444 CCGCTCACCCCATCTGCATCTAT No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714856_1179714862 -7 Left 1179714856 21:43281429-43281451 CCCCATCTGCATCTATAGGCGTG No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714852_1179714862 17 Left 1179714852 21:43281405-43281427 CCCAGGACAGGAGGTGGCCGCTC No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714853_1179714862 16 Left 1179714853 21:43281406-43281428 CCAGGACAGGAGGTGGCCGCTCA No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data
1179714857_1179714862 -8 Left 1179714857 21:43281430-43281452 CCCATCTGCATCTATAGGCGTGC No data
Right 1179714862 21:43281445-43281467 AGGCGTGCGCTGTGGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714862 Original CRISPR AGGCGTGCGCTGTGGGCGGC AGG Intergenic