ID: 1179714907

View in Genome Browser
Species Human (GRCh38)
Location 21:43281619-43281641
Sequence CAGGATGAACATCGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179714907_1179714920 16 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714920 21:43281658-43281680 AAAAGGGCGTGATGATTCTGGGG No data
1179714907_1179714918 14 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714918 21:43281656-43281678 GAAAAAGGGCGTGATGATTCTGG No data
1179714907_1179714917 0 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714917 21:43281642-43281664 GAGGGTGTAGAGATGAAAAAGGG No data
1179714907_1179714922 25 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714922 21:43281667-43281689 TGATGATTCTGGGGTTCCCTGGG No data
1179714907_1179714923 30 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714923 21:43281672-43281694 ATTCTGGGGTTCCCTGGGCTAGG No data
1179714907_1179714921 24 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714921 21:43281666-43281688 GTGATGATTCTGGGGTTCCCTGG No data
1179714907_1179714916 -1 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714916 21:43281641-43281663 GGAGGGTGTAGAGATGAAAAAGG No data
1179714907_1179714919 15 Left 1179714907 21:43281619-43281641 CCCTCCTCCCGATGTTCATCCTG No data
Right 1179714919 21:43281657-43281679 AAAAAGGGCGTGATGATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179714907 Original CRISPR CAGGATGAACATCGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr