ID: 1179716328

View in Genome Browser
Species Human (GRCh38)
Location 21:43290628-43290650
Sequence CTCACACCTGTGCGCACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179716328_1179716336 29 Left 1179716328 21:43290628-43290650 CCAACTGTGCGCACAGGTGTGAG No data
Right 1179716336 21:43290680-43290702 CCCCATGAGATTGGTCTTTCTGG No data
1179716328_1179716334 20 Left 1179716328 21:43290628-43290650 CCAACTGTGCGCACAGGTGTGAG No data
Right 1179716334 21:43290671-43290693 CCGTCATTTCCCCATGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179716328 Original CRISPR CTCACACCTGTGCGCACAGT TGG (reversed) Intergenic
No off target data available for this crispr