ID: 1179716472

View in Genome Browser
Species Human (GRCh38)
Location 21:43291209-43291231
Sequence CTCGCCGTACAGAAGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179716461_1179716472 12 Left 1179716461 21:43291174-43291196 CCAGGGCCTGGCTCAGCCTCACT No data
Right 1179716472 21:43291209-43291231 CTCGCCGTACAGAAGGAACTGGG No data
1179716465_1179716472 -4 Left 1179716465 21:43291190-43291212 CCTCACTGTGCCAGGGCCCCTCG No data
Right 1179716472 21:43291209-43291231 CTCGCCGTACAGAAGGAACTGGG No data
1179716462_1179716472 6 Left 1179716462 21:43291180-43291202 CCTGGCTCAGCCTCACTGTGCCA No data
Right 1179716472 21:43291209-43291231 CTCGCCGTACAGAAGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179716472 Original CRISPR CTCGCCGTACAGAAGGAACT GGG Intergenic
No off target data available for this crispr