ID: 1179718196

View in Genome Browser
Species Human (GRCh38)
Location 21:43300933-43300955
Sequence TCCCTGTTTGCCCTCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179718196_1179718204 6 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718204 21:43300962-43300984 TGGAGCCCGGCGCTCAGGACAGG No data
1179718196_1179718202 1 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718202 21:43300957-43300979 GGCCTTGGAGCCCGGCGCTCAGG No data
1179718196_1179718201 -7 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718201 21:43300949-43300971 ACAGGGAGGGCCTTGGAGCCCGG No data
1179718196_1179718208 21 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718208 21:43300977-43300999 AGGACAGGCCCCTGCTGGCCCGG No data
1179718196_1179718207 16 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179718196 Original CRISPR TCCCTGTTTGCCCTCAGGAA AGG (reversed) Intergenic
No off target data available for this crispr