ID: 1179718201

View in Genome Browser
Species Human (GRCh38)
Location 21:43300949-43300971
Sequence ACAGGGAGGGCCTTGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179718194_1179718201 -6 Left 1179718194 21:43300932-43300954 CCCTTTCCTGAGGGCAAACAGGG No data
Right 1179718201 21:43300949-43300971 ACAGGGAGGGCCTTGGAGCCCGG No data
1179718196_1179718201 -7 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718201 21:43300949-43300971 ACAGGGAGGGCCTTGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179718201 Original CRISPR ACAGGGAGGGCCTTGGAGCC CGG Intergenic
No off target data available for this crispr