ID: 1179718204

View in Genome Browser
Species Human (GRCh38)
Location 21:43300962-43300984
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179718196_1179718204 6 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718204 21:43300962-43300984 TGGAGCCCGGCGCTCAGGACAGG No data
1179718199_1179718204 1 Left 1179718199 21:43300938-43300960 CCTGAGGGCAAACAGGGAGGGCC No data
Right 1179718204 21:43300962-43300984 TGGAGCCCGGCGCTCAGGACAGG No data
1179718194_1179718204 7 Left 1179718194 21:43300932-43300954 CCCTTTCCTGAGGGCAAACAGGG No data
Right 1179718204 21:43300962-43300984 TGGAGCCCGGCGCTCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179718204 Original CRISPR TGGAGCCCGGCGCTCAGGAC AGG Intergenic
No off target data available for this crispr