ID: 1179718208

View in Genome Browser
Species Human (GRCh38)
Location 21:43300977-43300999
Sequence AGGACAGGCCCCTGCTGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179718199_1179718208 16 Left 1179718199 21:43300938-43300960 CCTGAGGGCAAACAGGGAGGGCC No data
Right 1179718208 21:43300977-43300999 AGGACAGGCCCCTGCTGGCCCGG No data
1179718194_1179718208 22 Left 1179718194 21:43300932-43300954 CCCTTTCCTGAGGGCAAACAGGG No data
Right 1179718208 21:43300977-43300999 AGGACAGGCCCCTGCTGGCCCGG No data
1179718203_1179718208 -5 Left 1179718203 21:43300959-43300981 CCTTGGAGCCCGGCGCTCAGGAC No data
Right 1179718208 21:43300977-43300999 AGGACAGGCCCCTGCTGGCCCGG No data
1179718196_1179718208 21 Left 1179718196 21:43300933-43300955 CCTTTCCTGAGGGCAAACAGGGA No data
Right 1179718208 21:43300977-43300999 AGGACAGGCCCCTGCTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179718208 Original CRISPR AGGACAGGCCCCTGCTGGCC CGG Intergenic
No off target data available for this crispr