ID: 1179718705

View in Genome Browser
Species Human (GRCh38)
Location 21:43303348-43303370
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179718705_1179718711 23 Left 1179718705 21:43303348-43303370 CCGGAGCTGCCCAAGGACACGAG No data
Right 1179718711 21:43303394-43303416 CCGCAGTGACTGCTGCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179718705 Original CRISPR CTCGTGTCCTTGGGCAGCTC CGG (reversed) Intergenic
No off target data available for this crispr