ID: 1179720517

View in Genome Browser
Species Human (GRCh38)
Location 21:43313782-43313804
Sequence GAGCCGGACCACGGCCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179720517_1179720524 -5 Left 1179720517 21:43313782-43313804 CCACCCAGGCCGTGGTCCGGCTC No data
Right 1179720524 21:43313800-43313822 GGCTCACCTGCTGCCCAGGGAGG No data
1179720517_1179720522 -8 Left 1179720517 21:43313782-43313804 CCACCCAGGCCGTGGTCCGGCTC No data
Right 1179720522 21:43313797-43313819 TCCGGCTCACCTGCTGCCCAGGG No data
1179720517_1179720529 17 Left 1179720517 21:43313782-43313804 CCACCCAGGCCGTGGTCCGGCTC No data
Right 1179720529 21:43313822-43313844 GGTGCTCACATGCACGCCCTTGG No data
1179720517_1179720521 -9 Left 1179720517 21:43313782-43313804 CCACCCAGGCCGTGGTCCGGCTC No data
Right 1179720521 21:43313796-43313818 GTCCGGCTCACCTGCTGCCCAGG No data
1179720517_1179720525 -4 Left 1179720517 21:43313782-43313804 CCACCCAGGCCGTGGTCCGGCTC No data
Right 1179720525 21:43313801-43313823 GCTCACCTGCTGCCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179720517 Original CRISPR GAGCCGGACCACGGCCTGGG TGG (reversed) Intergenic