ID: 1179722907

View in Genome Browser
Species Human (GRCh38)
Location 21:43325497-43325519
Sequence CCAGGGCCACATGTGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179722907_1179722921 19 Left 1179722907 21:43325497-43325519 CCTTGCACCACATGTGGCCCTGG No data
Right 1179722921 21:43325539-43325561 CCTCTCATCTGTAAAGTGGGTGG No data
1179722907_1179722913 -5 Left 1179722907 21:43325497-43325519 CCTTGCACCACATGTGGCCCTGG No data
Right 1179722913 21:43325515-43325537 CCTGGCCAGGTCCCCACTCTAGG No data
1179722907_1179722918 15 Left 1179722907 21:43325497-43325519 CCTTGCACCACATGTGGCCCTGG No data
Right 1179722918 21:43325535-43325557 AGGTCCTCTCATCTGTAAAGTGG No data
1179722907_1179722922 26 Left 1179722907 21:43325497-43325519 CCTTGCACCACATGTGGCCCTGG No data
Right 1179722922 21:43325546-43325568 TCTGTAAAGTGGGTGGTGCAAGG No data
1179722907_1179722919 16 Left 1179722907 21:43325497-43325519 CCTTGCACCACATGTGGCCCTGG No data
Right 1179722919 21:43325536-43325558 GGTCCTCTCATCTGTAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179722907 Original CRISPR CCAGGGCCACATGTGGTGCA AGG (reversed) Intergenic
No off target data available for this crispr