ID: 1179724126

View in Genome Browser
Species Human (GRCh38)
Location 21:43332333-43332355
Sequence GTAGACACAATGACATCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179724123_1179724126 -5 Left 1179724123 21:43332315-43332337 CCAGGGCCCGACAGCACTGTAGA No data
Right 1179724126 21:43332333-43332355 GTAGACACAATGACATCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179724126 Original CRISPR GTAGACACAATGACATCACT CGG Intergenic
No off target data available for this crispr