ID: 1179724681

View in Genome Browser
Species Human (GRCh38)
Location 21:43335511-43335533
Sequence CTGGGGTAGGAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179724674_1179724681 -6 Left 1179724674 21:43335494-43335516 CCTCAGGTGAACCACAGCTGGGG No data
Right 1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179724681 Original CRISPR CTGGGGTAGGAGAGGGCAGG AGG Intergenic
No off target data available for this crispr