ID: 1179731974

View in Genome Browser
Species Human (GRCh38)
Location 21:43373117-43373139
Sequence CGGCGACCGGGACGTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179731974_1179731987 17 Left 1179731974 21:43373117-43373139 CCAATGGCACGTCCCGGTCGCCG No data
Right 1179731987 21:43373157-43373179 CCGGAGCCACAGAGCTGCCAGGG No data
1179731974_1179731985 16 Left 1179731974 21:43373117-43373139 CCAATGGCACGTCCCGGTCGCCG No data
Right 1179731985 21:43373156-43373178 CCCGGAGCCACAGAGCTGCCAGG No data
1179731974_1179731982 -2 Left 1179731974 21:43373117-43373139 CCAATGGCACGTCCCGGTCGCCG No data
Right 1179731982 21:43373138-43373160 CGGCCGGGTGTGGTGCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179731974 Original CRISPR CGGCGACCGGGACGTGCCAT TGG (reversed) Intergenic
No off target data available for this crispr