ID: 1179733837

View in Genome Browser
Species Human (GRCh38)
Location 21:43381338-43381360
Sequence TGCCCCAGAGGCCCCACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179733826_1179733837 10 Left 1179733826 21:43381305-43381327 CCCCACTTCCTCTCTGGGGACTG No data
Right 1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG No data
1179733834_1179733837 2 Left 1179733834 21:43381313-43381335 CCTCTCTGGGGACTGGGGGTGGA No data
Right 1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG No data
1179733829_1179733837 8 Left 1179733829 21:43381307-43381329 CCACTTCCTCTCTGGGGACTGGG No data
Right 1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG No data
1179733822_1179733837 17 Left 1179733822 21:43381298-43381320 CCGCGCTCCCCACTTCCTCTCTG No data
Right 1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG No data
1179733827_1179733837 9 Left 1179733827 21:43381306-43381328 CCCACTTCCTCTCTGGGGACTGG No data
Right 1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG No data
1179733821_1179733837 18 Left 1179733821 21:43381297-43381319 CCCGCGCTCCCCACTTCCTCTCT No data
Right 1179733837 21:43381338-43381360 TGCCCCAGAGGCCCCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179733837 Original CRISPR TGCCCCAGAGGCCCCACCAA AGG Intergenic