ID: 1179734253

View in Genome Browser
Species Human (GRCh38)
Location 21:43383218-43383240
Sequence GTGTGGATAGTGAGGATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179734247_1179734253 1 Left 1179734247 21:43383194-43383216 CCGTTGTTTATCCAGCAACAAGC No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734244_1179734253 22 Left 1179734244 21:43383173-43383195 CCGAGCCTCCAAAGAAAGGAGCC No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734237_1179734253 30 Left 1179734237 21:43383165-43383187 CCCCTCCCCCGAGCCTCCAAAGA No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734238_1179734253 29 Left 1179734238 21:43383166-43383188 CCCTCCCCCGAGCCTCCAAAGAA No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734243_1179734253 23 Left 1179734243 21:43383172-43383194 CCCGAGCCTCCAAAGAAAGGAGC No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734246_1179734253 14 Left 1179734246 21:43383181-43383203 CCAAAGAAAGGAGCCGTTGTTTA No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734245_1179734253 17 Left 1179734245 21:43383178-43383200 CCTCCAAAGAAAGGAGCCGTTGT No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734239_1179734253 28 Left 1179734239 21:43383167-43383189 CCTCCCCCGAGCCTCCAAAGAAA No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734242_1179734253 24 Left 1179734242 21:43383171-43383193 CCCCGAGCCTCCAAAGAAAGGAG No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734249_1179734253 -10 Left 1179734249 21:43383205-43383227 CCAGCAACAAGCCGTGTGGATAG No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data
1179734241_1179734253 25 Left 1179734241 21:43383170-43383192 CCCCCGAGCCTCCAAAGAAAGGA No data
Right 1179734253 21:43383218-43383240 GTGTGGATAGTGAGGATCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179734253 Original CRISPR GTGTGGATAGTGAGGATCCC GGG Intergenic
No off target data available for this crispr