ID: 1179735286

View in Genome Browser
Species Human (GRCh38)
Location 21:43388102-43388124
Sequence CGCCCTGGGGTTGCGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179735280_1179735286 -7 Left 1179735280 21:43388086-43388108 CCTCGCCAGTTGCTGACGCCCTG No data
Right 1179735286 21:43388102-43388124 CGCCCTGGGGTTGCGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179735286 Original CRISPR CGCCCTGGGGTTGCGTCTGA GGG Intergenic
No off target data available for this crispr