ID: 1179735763

View in Genome Browser
Species Human (GRCh38)
Location 21:43391016-43391038
Sequence AATGGCCTTGTGAGGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179735763_1179735775 16 Left 1179735763 21:43391016-43391038 CCTCCAGTCCTCACAAGGCCATT No data
Right 1179735775 21:43391055-43391077 CCTCACAGGCTATTGGCGGGAGG No data
1179735763_1179735773 13 Left 1179735763 21:43391016-43391038 CCTCCAGTCCTCACAAGGCCATT No data
Right 1179735773 21:43391052-43391074 GCTCCTCACAGGCTATTGGCGGG No data
1179735763_1179735776 29 Left 1179735763 21:43391016-43391038 CCTCCAGTCCTCACAAGGCCATT No data
Right 1179735776 21:43391068-43391090 TGGCGGGAGGCCTCAGTCCCTGG No data
1179735763_1179735772 12 Left 1179735763 21:43391016-43391038 CCTCCAGTCCTCACAAGGCCATT No data
Right 1179735772 21:43391051-43391073 AGCTCCTCACAGGCTATTGGCGG No data
1179735763_1179735771 9 Left 1179735763 21:43391016-43391038 CCTCCAGTCCTCACAAGGCCATT No data
Right 1179735771 21:43391048-43391070 TGCAGCTCCTCACAGGCTATTGG No data
1179735763_1179735770 2 Left 1179735763 21:43391016-43391038 CCTCCAGTCCTCACAAGGCCATT No data
Right 1179735770 21:43391041-43391063 TGGAGGCTGCAGCTCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179735763 Original CRISPR AATGGCCTTGTGAGGACTGG AGG (reversed) Intergenic
No off target data available for this crispr