ID: 1179735866

View in Genome Browser
Species Human (GRCh38)
Location 21:43391643-43391665
Sequence AATCACATGAGCCAGTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179735862_1179735866 21 Left 1179735862 21:43391599-43391621 CCTCCGTCTCCAGGTGGCAGGTC No data
Right 1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG No data
1179735860_1179735866 24 Left 1179735860 21:43391596-43391618 CCTCCTCCGTCTCCAGGTGGCAG No data
Right 1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG No data
1179735859_1179735866 25 Left 1179735859 21:43391595-43391617 CCCTCCTCCGTCTCCAGGTGGCA No data
Right 1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG No data
1179735863_1179735866 18 Left 1179735863 21:43391602-43391624 CCGTCTCCAGGTGGCAGGTCTCA No data
Right 1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG No data
1179735865_1179735866 12 Left 1179735865 21:43391608-43391630 CCAGGTGGCAGGTCTCAGGACAT No data
Right 1179735866 21:43391643-43391665 AATCACATGAGCCAGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179735866 Original CRISPR AATCACATGAGCCAGTTCCC TGG Intergenic
No off target data available for this crispr