ID: 1179736987

View in Genome Browser
Species Human (GRCh38)
Location 21:43397563-43397585
Sequence GCGTGTGCCCGTGTGTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179736987_1179736989 -8 Left 1179736987 21:43397563-43397585 CCCAAGCACACACGGGCACACGC No data
Right 1179736989 21:43397578-43397600 GCACACGCCCCTCCCACCTCCGG No data
1179736987_1179737000 22 Left 1179736987 21:43397563-43397585 CCCAAGCACACACGGGCACACGC No data
Right 1179737000 21:43397608-43397630 CCTGCCAGAGTCCACCCTCCTGG No data
1179736987_1179736990 -7 Left 1179736987 21:43397563-43397585 CCCAAGCACACACGGGCACACGC No data
Right 1179736990 21:43397579-43397601 CACACGCCCCTCCCACCTCCGGG No data
1179736987_1179737003 29 Left 1179736987 21:43397563-43397585 CCCAAGCACACACGGGCACACGC No data
Right 1179737003 21:43397615-43397637 GAGTCCACCCTCCTGGGCACAGG No data
1179736987_1179737004 30 Left 1179736987 21:43397563-43397585 CCCAAGCACACACGGGCACACGC No data
Right 1179737004 21:43397616-43397638 AGTCCACCCTCCTGGGCACAGGG No data
1179736987_1179737001 23 Left 1179736987 21:43397563-43397585 CCCAAGCACACACGGGCACACGC No data
Right 1179737001 21:43397609-43397631 CTGCCAGAGTCCACCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179736987 Original CRISPR GCGTGTGCCCGTGTGTGCTT GGG (reversed) Intergenic
No off target data available for this crispr