ID: 1179738681

View in Genome Browser
Species Human (GRCh38)
Location 21:43404293-43404315
Sequence CCAGCTGTCCAGAGGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738681_1179738693 20 Left 1179738681 21:43404293-43404315 CCCTATGCCCTCTGGACAGCTGG No data
Right 1179738693 21:43404336-43404358 CCTTCTCCTACTTGCTCTATGGG No data
1179738681_1179738691 19 Left 1179738681 21:43404293-43404315 CCCTATGCCCTCTGGACAGCTGG No data
Right 1179738691 21:43404335-43404357 TCCTTCTCCTACTTGCTCTATGG No data
1179738681_1179738694 21 Left 1179738681 21:43404293-43404315 CCCTATGCCCTCTGGACAGCTGG No data
Right 1179738694 21:43404337-43404359 CTTCTCCTACTTGCTCTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738681 Original CRISPR CCAGCTGTCCAGAGGGCATA GGG (reversed) Intergenic
No off target data available for this crispr