ID: 1179738773

View in Genome Browser
Species Human (GRCh38)
Location 21:43404715-43404737
Sequence GCGTGACGTCTGGCACCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738773_1179738779 8 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738779 21:43404746-43404768 GCAAATCCTACAGCCGGAACTGG No data
1179738773_1179738778 2 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738778 21:43404740-43404762 GGCAAGGCAAATCCTACAGCCGG No data
1179738773_1179738782 18 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738782 21:43404756-43404778 CAGCCGGAACTGGCTGGCTCCGG No data
1179738773_1179738784 24 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738784 21:43404762-43404784 GAACTGGCTGGCTCCGGTGCAGG No data
1179738773_1179738780 12 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738780 21:43404750-43404772 ATCCTACAGCCGGAACTGGCTGG No data
1179738773_1179738785 29 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738785 21:43404767-43404789 GGCTGGCTCCGGTGCAGGCTTGG No data
1179738773_1179738786 30 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738773 Original CRISPR GCGTGACGTCTGGCACCTGG CGG (reversed) Intergenic