ID: 1179738774

View in Genome Browser
Species Human (GRCh38)
Location 21:43404718-43404740
Sequence CACGCGTGACGTCTGGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738774_1179738785 26 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738785 21:43404767-43404789 GGCTGGCTCCGGTGCAGGCTTGG No data
1179738774_1179738778 -1 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738778 21:43404740-43404762 GGCAAGGCAAATCCTACAGCCGG No data
1179738774_1179738782 15 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738782 21:43404756-43404778 CAGCCGGAACTGGCTGGCTCCGG No data
1179738774_1179738779 5 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738779 21:43404746-43404768 GCAAATCCTACAGCCGGAACTGG No data
1179738774_1179738786 27 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data
1179738774_1179738784 21 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738784 21:43404762-43404784 GAACTGGCTGGCTCCGGTGCAGG No data
1179738774_1179738780 9 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738780 21:43404750-43404772 ATCCTACAGCCGGAACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738774 Original CRISPR CACGCGTGACGTCTGGCACC TGG (reversed) Intergenic