ID: 1179738777

View in Genome Browser
Species Human (GRCh38)
Location 21:43404725-43404747
Sequence GCCTTGCCACGCGTGACGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738777_1179738779 -2 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738779 21:43404746-43404768 GCAAATCCTACAGCCGGAACTGG No data
1179738777_1179738778 -8 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738778 21:43404740-43404762 GGCAAGGCAAATCCTACAGCCGG No data
1179738777_1179738786 20 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data
1179738777_1179738788 29 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738788 21:43404777-43404799 GGTGCAGGCTTGGGACTTGTAGG No data
1179738777_1179738785 19 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738785 21:43404767-43404789 GGCTGGCTCCGGTGCAGGCTTGG No data
1179738777_1179738784 14 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738784 21:43404762-43404784 GAACTGGCTGGCTCCGGTGCAGG No data
1179738777_1179738780 2 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738780 21:43404750-43404772 ATCCTACAGCCGGAACTGGCTGG No data
1179738777_1179738782 8 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738782 21:43404756-43404778 CAGCCGGAACTGGCTGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738777 Original CRISPR GCCTTGCCACGCGTGACGTC TGG (reversed) Intergenic
No off target data available for this crispr