ID: 1179738778 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:43404740-43404762 |
| Sequence | GGCAAGGCAAATCCTACAGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1179738774_1179738778 | -1 | Left | 1179738774 | 21:43404718-43404740 | CCAGGTGCCAGACGTCACGCGTG | No data | ||
| Right | 1179738778 | 21:43404740-43404762 | GGCAAGGCAAATCCTACAGCCGG | No data | ||||
| 1179738777_1179738778 | -8 | Left | 1179738777 | 21:43404725-43404747 | CCAGACGTCACGCGTGGCAAGGC | No data | ||
| Right | 1179738778 | 21:43404740-43404762 | GGCAAGGCAAATCCTACAGCCGG | No data | ||||
| 1179738773_1179738778 | 2 | Left | 1179738773 | 21:43404715-43404737 | CCGCCAGGTGCCAGACGTCACGC | No data | ||
| Right | 1179738778 | 21:43404740-43404762 | GGCAAGGCAAATCCTACAGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1179738778 | Original CRISPR | GGCAAGGCAAATCCTACAGC CGG | Intergenic | ||