ID: 1179738780

View in Genome Browser
Species Human (GRCh38)
Location 21:43404750-43404772
Sequence ATCCTACAGCCGGAACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738777_1179738780 2 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738780 21:43404750-43404772 ATCCTACAGCCGGAACTGGCTGG No data
1179738774_1179738780 9 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738780 21:43404750-43404772 ATCCTACAGCCGGAACTGGCTGG No data
1179738773_1179738780 12 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738780 21:43404750-43404772 ATCCTACAGCCGGAACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738780 Original CRISPR ATCCTACAGCCGGAACTGGC TGG Intergenic