ID: 1179738781

View in Genome Browser
Species Human (GRCh38)
Location 21:43404752-43404774
Sequence AGCCAGCCAGTTCCGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738781_1179738786 -7 Left 1179738781 21:43404752-43404774 CCTACAGCCGGAACTGGCTGGCT No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data
1179738781_1179738785 -8 Left 1179738781 21:43404752-43404774 CCTACAGCCGGAACTGGCTGGCT No data
Right 1179738785 21:43404767-43404789 GGCTGGCTCCGGTGCAGGCTTGG No data
1179738781_1179738788 2 Left 1179738781 21:43404752-43404774 CCTACAGCCGGAACTGGCTGGCT No data
Right 1179738788 21:43404777-43404799 GGTGCAGGCTTGGGACTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738781 Original CRISPR AGCCAGCCAGTTCCGGCTGT AGG (reversed) Intergenic