ID: 1179738783

View in Genome Browser
Species Human (GRCh38)
Location 21:43404759-43404781
Sequence GCACCGGAGCCAGCCAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738783_1179738788 -5 Left 1179738783 21:43404759-43404781 CCGGAACTGGCTGGCTCCGGTGC No data
Right 1179738788 21:43404777-43404799 GGTGCAGGCTTGGGACTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738783 Original CRISPR GCACCGGAGCCAGCCAGTTC CGG (reversed) Intergenic