ID: 1179738786

View in Genome Browser
Species Human (GRCh38)
Location 21:43404768-43404790
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738774_1179738786 27 Left 1179738774 21:43404718-43404740 CCAGGTGCCAGACGTCACGCGTG No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data
1179738773_1179738786 30 Left 1179738773 21:43404715-43404737 CCGCCAGGTGCCAGACGTCACGC No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data
1179738777_1179738786 20 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data
1179738781_1179738786 -7 Left 1179738781 21:43404752-43404774 CCTACAGCCGGAACTGGCTGGCT No data
Right 1179738786 21:43404768-43404790 GCTGGCTCCGGTGCAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738786 Original CRISPR GCTGGCTCCGGTGCAGGCTT GGG Intergenic