ID: 1179738788

View in Genome Browser
Species Human (GRCh38)
Location 21:43404777-43404799
Sequence GGTGCAGGCTTGGGACTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179738783_1179738788 -5 Left 1179738783 21:43404759-43404781 CCGGAACTGGCTGGCTCCGGTGC No data
Right 1179738788 21:43404777-43404799 GGTGCAGGCTTGGGACTTGTAGG No data
1179738781_1179738788 2 Left 1179738781 21:43404752-43404774 CCTACAGCCGGAACTGGCTGGCT No data
Right 1179738788 21:43404777-43404799 GGTGCAGGCTTGGGACTTGTAGG No data
1179738777_1179738788 29 Left 1179738777 21:43404725-43404747 CCAGACGTCACGCGTGGCAAGGC No data
Right 1179738788 21:43404777-43404799 GGTGCAGGCTTGGGACTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179738788 Original CRISPR GGTGCAGGCTTGGGACTTGT AGG Intergenic