ID: 1179739344

View in Genome Browser
Species Human (GRCh38)
Location 21:43409580-43409602
Sequence CCGTGCCCTTGCCGTGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179739344_1179739349 -6 Left 1179739344 21:43409580-43409602 CCGGGAACACGGCAAGGGCACGG No data
Right 1179739349 21:43409597-43409619 GCACGGAGCGGAGAGCCCAGGGG No data
1179739344_1179739347 -8 Left 1179739344 21:43409580-43409602 CCGGGAACACGGCAAGGGCACGG No data
Right 1179739347 21:43409595-43409617 GGGCACGGAGCGGAGAGCCCAGG No data
1179739344_1179739354 12 Left 1179739344 21:43409580-43409602 CCGGGAACACGGCAAGGGCACGG No data
Right 1179739354 21:43409615-43409637 AGGGGAGCTTTCTGGGTGACAGG No data
1179739344_1179739350 4 Left 1179739344 21:43409580-43409602 CCGGGAACACGGCAAGGGCACGG No data
Right 1179739350 21:43409607-43409629 GAGAGCCCAGGGGAGCTTTCTGG No data
1179739344_1179739351 5 Left 1179739344 21:43409580-43409602 CCGGGAACACGGCAAGGGCACGG No data
Right 1179739351 21:43409608-43409630 AGAGCCCAGGGGAGCTTTCTGGG No data
1179739344_1179739348 -7 Left 1179739344 21:43409580-43409602 CCGGGAACACGGCAAGGGCACGG No data
Right 1179739348 21:43409596-43409618 GGCACGGAGCGGAGAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179739344 Original CRISPR CCGTGCCCTTGCCGTGTTCC CGG (reversed) Intergenic
No off target data available for this crispr