ID: 1179739695

View in Genome Browser
Species Human (GRCh38)
Location 21:43411202-43411224
Sequence CAGGGTGCACAGTGGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179739695_1179739706 17 Left 1179739695 21:43411202-43411224 CCCAGGGCCCACTGTGCACCCTG No data
Right 1179739706 21:43411242-43411264 ACGGGAGCGGCCTGCTGACCCGG No data
1179739695_1179739701 -2 Left 1179739695 21:43411202-43411224 CCCAGGGCCCACTGTGCACCCTG No data
Right 1179739701 21:43411223-43411245 TGCATGTCGCGCCCTTGTCACGG No data
1179739695_1179739702 -1 Left 1179739695 21:43411202-43411224 CCCAGGGCCCACTGTGCACCCTG No data
Right 1179739702 21:43411224-43411246 GCATGTCGCGCCCTTGTCACGGG No data
1179739695_1179739708 28 Left 1179739695 21:43411202-43411224 CCCAGGGCCCACTGTGCACCCTG No data
Right 1179739708 21:43411253-43411275 CTGCTGACCCGGAGCACGCGTGG No data
1179739695_1179739703 4 Left 1179739695 21:43411202-43411224 CCCAGGGCCCACTGTGCACCCTG No data
Right 1179739703 21:43411229-43411251 TCGCGCCCTTGTCACGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179739695 Original CRISPR CAGGGTGCACAGTGGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr