ID: 1179740269

View in Genome Browser
Species Human (GRCh38)
Location 21:43414263-43414285
Sequence GCCACTGGGGAAGGGTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179740257_1179740269 21 Left 1179740257 21:43414219-43414241 CCGGCAGCCCCGGGCGGTGCTGA No data
Right 1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG No data
1179740258_1179740269 14 Left 1179740258 21:43414226-43414248 CCCCGGGCGGTGCTGAGACTTTC No data
Right 1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG No data
1179740260_1179740269 12 Left 1179740260 21:43414228-43414250 CCGGGCGGTGCTGAGACTTTCAG No data
Right 1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG No data
1179740259_1179740269 13 Left 1179740259 21:43414227-43414249 CCCGGGCGGTGCTGAGACTTTCA No data
Right 1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179740269 Original CRISPR GCCACTGGGGAAGGGTCCTG AGG Intergenic
No off target data available for this crispr