ID: 1179743449

View in Genome Browser
Species Human (GRCh38)
Location 21:43430471-43430493
Sequence CCATTTAAGCAGCCCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179743449_1179743456 20 Left 1179743449 21:43430471-43430493 CCTTCCACGGGCTGCTTAAATGG No data
Right 1179743456 21:43430514-43430536 AGCAGAAACGTGCCTGTTCACGG No data
1179743449_1179743457 21 Left 1179743449 21:43430471-43430493 CCTTCCACGGGCTGCTTAAATGG No data
Right 1179743457 21:43430515-43430537 GCAGAAACGTGCCTGTTCACGGG No data
1179743449_1179743453 -9 Left 1179743449 21:43430471-43430493 CCTTCCACGGGCTGCTTAAATGG No data
Right 1179743453 21:43430485-43430507 CTTAAATGGACCACGAAGGCCGG No data
1179743449_1179743458 29 Left 1179743449 21:43430471-43430493 CCTTCCACGGGCTGCTTAAATGG No data
Right 1179743458 21:43430523-43430545 GTGCCTGTTCACGGGCCAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179743449 Original CRISPR CCATTTAAGCAGCCCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr