ID: 1179744300

View in Genome Browser
Species Human (GRCh38)
Location 21:43435015-43435037
Sequence GAGTTTCATTTTTAACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179744300_1179744302 12 Left 1179744300 21:43435015-43435037 CCATGCAGTTAAAAATGAAACTC No data
Right 1179744302 21:43435050-43435072 TATTGAATTCAGTACTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179744300 Original CRISPR GAGTTTCATTTTTAACTGCA TGG (reversed) Intergenic
No off target data available for this crispr