ID: 1179745913

View in Genome Browser
Species Human (GRCh38)
Location 21:43444194-43444216
Sequence CAGCATATGGAGAACGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179745902_1179745913 23 Left 1179745902 21:43444148-43444170 CCAGATGAGCCAGGGGAAGCAGC No data
Right 1179745913 21:43444194-43444216 CAGCATATGGAGAACGCGGCAGG No data
1179745903_1179745913 14 Left 1179745903 21:43444157-43444179 CCAGGGGAAGCAGCTGCGCCTGC No data
Right 1179745913 21:43444194-43444216 CAGCATATGGAGAACGCGGCAGG No data
1179745904_1179745913 -4 Left 1179745904 21:43444175-43444197 CCTGCAGCCACCCCCACTCCAGC No data
Right 1179745913 21:43444194-43444216 CAGCATATGGAGAACGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179745913 Original CRISPR CAGCATATGGAGAACGCGGC AGG Intergenic
No off target data available for this crispr