ID: 1179747605

View in Genome Browser
Species Human (GRCh38)
Location 21:43451589-43451611
Sequence CCTTGGGGCTCCTGCTCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179747605_1179747617 -2 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747617 21:43451610-43451632 GGGAGGCTTGGCGGCTGTGGAGG No data
1179747605_1179747623 28 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data
1179747605_1179747620 20 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747605_1179747619 6 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747605_1179747618 5 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747618 21:43451617-43451639 TTGGCGGCTGTGGAGGCGAGTGG No data
1179747605_1179747622 24 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747622 21:43451636-43451658 GTGGGCCACGTGTAGCTGGGAGG No data
1179747605_1179747616 -5 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747605_1179747621 21 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747621 21:43451633-43451655 CGAGTGGGCCACGTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179747605 Original CRISPR CCTTGGGGCTCCTGCTCTCG GGG (reversed) Intergenic
No off target data available for this crispr