ID: 1179747616

View in Genome Browser
Species Human (GRCh38)
Location 21:43451607-43451629
Sequence CAAGGGAGGCTTGGCGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179747605_1179747616 -5 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747602_1179747616 4 Left 1179747602 21:43451580-43451602 CCAGCCCAGCCCCGAGAGCAGGA No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747604_1179747616 -1 Left 1179747604 21:43451585-43451607 CCAGCCCCGAGAGCAGGAGCCCC No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747599_1179747616 8 Left 1179747599 21:43451576-43451598 CCCTCCAGCCCAGCCCCGAGAGC No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747609_1179747616 -7 Left 1179747609 21:43451591-43451613 CCGAGAGCAGGAGCCCCAAGGGA No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747596_1179747616 15 Left 1179747596 21:43451569-43451591 CCCAGGCCCCTCCAGCCCAGCCC No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747595_1179747616 26 Left 1179747595 21:43451558-43451580 CCGCTGGGACTCCCAGGCCCCTC No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747594_1179747616 27 Left 1179747594 21:43451557-43451579 CCCGCTGGGACTCCCAGGCCCCT No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747603_1179747616 0 Left 1179747603 21:43451584-43451606 CCCAGCCCCGAGAGCAGGAGCCC No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747598_1179747616 9 Left 1179747598 21:43451575-43451597 CCCCTCCAGCCCAGCCCCGAGAG No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747600_1179747616 7 Left 1179747600 21:43451577-43451599 CCTCCAGCCCAGCCCCGAGAGCA No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747607_1179747616 -6 Left 1179747607 21:43451590-43451612 CCCGAGAGCAGGAGCCCCAAGGG No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data
1179747597_1179747616 14 Left 1179747597 21:43451570-43451592 CCAGGCCCCTCCAGCCCAGCCCC No data
Right 1179747616 21:43451607-43451629 CAAGGGAGGCTTGGCGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179747616 Original CRISPR CAAGGGAGGCTTGGCGGCTG TGG Intergenic
No off target data available for this crispr