ID: 1179747619

View in Genome Browser
Species Human (GRCh38)
Location 21:43451618-43451640
Sequence TGGCGGCTGTGGAGGCGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179747605_1179747619 6 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747613_1179747619 -9 Left 1179747613 21:43451604-43451626 CCCCAAGGGAGGCTTGGCGGCTG No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747597_1179747619 25 Left 1179747597 21:43451570-43451592 CCAGGCCCCTCCAGCCCAGCCCC No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747603_1179747619 11 Left 1179747603 21:43451584-43451606 CCCAGCCCCGAGAGCAGGAGCCC No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747596_1179747619 26 Left 1179747596 21:43451569-43451591 CCCAGGCCCCTCCAGCCCAGCCC No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747600_1179747619 18 Left 1179747600 21:43451577-43451599 CCTCCAGCCCAGCCCCGAGAGCA No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747614_1179747619 -10 Left 1179747614 21:43451605-43451627 CCCAAGGGAGGCTTGGCGGCTGT No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747598_1179747619 20 Left 1179747598 21:43451575-43451597 CCCCTCCAGCCCAGCCCCGAGAG No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747599_1179747619 19 Left 1179747599 21:43451576-43451598 CCCTCCAGCCCAGCCCCGAGAGC No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747609_1179747619 4 Left 1179747609 21:43451591-43451613 CCGAGAGCAGGAGCCCCAAGGGA No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747607_1179747619 5 Left 1179747607 21:43451590-43451612 CCCGAGAGCAGGAGCCCCAAGGG No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747604_1179747619 10 Left 1179747604 21:43451585-43451607 CCAGCCCCGAGAGCAGGAGCCCC No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data
1179747602_1179747619 15 Left 1179747602 21:43451580-43451602 CCAGCCCAGCCCCGAGAGCAGGA No data
Right 1179747619 21:43451618-43451640 TGGCGGCTGTGGAGGCGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179747619 Original CRISPR TGGCGGCTGTGGAGGCGAGT GGG Intergenic
No off target data available for this crispr