ID: 1179747620

View in Genome Browser
Species Human (GRCh38)
Location 21:43451632-43451654
Sequence GCGAGTGGGCCACGTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179747604_1179747620 24 Left 1179747604 21:43451585-43451607 CCAGCCCCGAGAGCAGGAGCCCC No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747607_1179747620 19 Left 1179747607 21:43451590-43451612 CCCGAGAGCAGGAGCCCCAAGGG No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747603_1179747620 25 Left 1179747603 21:43451584-43451606 CCCAGCCCCGAGAGCAGGAGCCC No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747614_1179747620 4 Left 1179747614 21:43451605-43451627 CCCAAGGGAGGCTTGGCGGCTGT No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747609_1179747620 18 Left 1179747609 21:43451591-43451613 CCGAGAGCAGGAGCCCCAAGGGA No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747605_1179747620 20 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747615_1179747620 3 Left 1179747615 21:43451606-43451628 CCAAGGGAGGCTTGGCGGCTGTG No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747613_1179747620 5 Left 1179747613 21:43451604-43451626 CCCCAAGGGAGGCTTGGCGGCTG No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data
1179747602_1179747620 29 Left 1179747602 21:43451580-43451602 CCAGCCCAGCCCCGAGAGCAGGA No data
Right 1179747620 21:43451632-43451654 GCGAGTGGGCCACGTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179747620 Original CRISPR GCGAGTGGGCCACGTGTAGC TGG Intergenic
No off target data available for this crispr