ID: 1179747623

View in Genome Browser
Species Human (GRCh38)
Location 21:43451640-43451662
Sequence GCCACGTGTAGCTGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179747609_1179747623 26 Left 1179747609 21:43451591-43451613 CCGAGAGCAGGAGCCCCAAGGGA No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data
1179747607_1179747623 27 Left 1179747607 21:43451590-43451612 CCCGAGAGCAGGAGCCCCAAGGG No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data
1179747614_1179747623 12 Left 1179747614 21:43451605-43451627 CCCAAGGGAGGCTTGGCGGCTGT No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data
1179747615_1179747623 11 Left 1179747615 21:43451606-43451628 CCAAGGGAGGCTTGGCGGCTGTG No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data
1179747613_1179747623 13 Left 1179747613 21:43451604-43451626 CCCCAAGGGAGGCTTGGCGGCTG No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data
1179747605_1179747623 28 Left 1179747605 21:43451589-43451611 CCCCGAGAGCAGGAGCCCCAAGG No data
Right 1179747623 21:43451640-43451662 GCCACGTGTAGCTGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179747623 Original CRISPR GCCACGTGTAGCTGGGAGGC CGG Intergenic
No off target data available for this crispr