ID: 1179748818

View in Genome Browser
Species Human (GRCh38)
Location 21:43457221-43457243
Sequence ATGGAGAAACTGACAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179748818_1179748824 13 Left 1179748818 21:43457221-43457243 CCCTTCTCTGTCAGTTTCTCCAT No data
Right 1179748824 21:43457257-43457279 GATAAATGAGAGTTCCCATCGGG No data
1179748818_1179748823 12 Left 1179748818 21:43457221-43457243 CCCTTCTCTGTCAGTTTCTCCAT No data
Right 1179748823 21:43457256-43457278 TGATAAATGAGAGTTCCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179748818 Original CRISPR ATGGAGAAACTGACAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr